Detail of EST/Unigene BI263374 |
Acc. | BI263374 |
Internal Acc. | NF089H02PL1F1028 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit b, chloroplastic OS=Cicer arietinum E-value=5e-20; ATP synthase subunit b, chloroplastic OS=Glycine max E-value=2e-18; ATP synthase subunit b, chloroplastic OS=Liriodendron tulipifera E-value=9e-18; ATP synthase subunit b, chloroplastic OS=Manihot esculenta E-value=2e-17; ATP synthase subunit b, chloroplastic OS=Nicotiana tabacum E-value=3e-17; |
Length | 571 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CGAGCGCCCCCTTTTTTAATTTAGAATTGAAAACAACCTAGATATTTTGCAATTGACATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |