Detail of EST/Unigene BI263404 |
Acc. | BI263404 |
Internal Acc. | NF084C05PL1F1038 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoglucomutase, cytoplasmic OS=Pisum sativum E-value=0; Phosphoglucomutase, cytoplasmic OS=Populus tremula E-value=6e-97; Phosphoglucomutase, cytoplasmic OS=Solanum tuberosum E-value=3e-96; Probable phosphoglucomutase, cytoplasmic 2 OS=Arabidopsis thaliana E-value=1e-94; Probable phosphoglucomutase, cytoplasmic 1 OS=Arabidopsis thaliana E-value=3e-92; |
Length | 678 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CAACCATGGTGCTCTTCAATGTCTCCCGTATTGAAACTACTCCTTTCGATGGACAGAAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K01835 phosphoglucomutase |
EC | 5.4.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843410 |
Trichome-related Gene from Literature | N/A |