Detail of EST/Unigene BI263624 |
Acc. | BI263624 |
Internal Acc. | NF090E06PL1F1051 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastoglobulin-1, chloroplastic OS=Pisum sativum E-value=5e-49; Plastid lipid-associated protein 3, chloroplastic OS=Brassica campestris E-value=6e-38; Probable plastid-lipid-associated protein 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-37; Probable plastid-lipid-associated protein 3, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-34; Plastid lipid-associated protein 2, chloroplastic OS=Brassica campestris E-value=7e-23; |
Length | 531 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AGGTTACATTCAAAGAAGGATCACTACAGCCTCCAGAGATAAAGTCTAAAATTGACCTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818114 |
Trichome-related Gene from Literature | N/A |