Detail of EST/Unigene BI263683 |
Acc. | BI263683 |
Internal Acc. | NF088G03PL1F1024 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=2e-76; Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=1e-74; Chlorophyll a-b binding protein 1B-21, chloroplastic OS=Hordeum vulgare Ib-21 E-value=1e-70; Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=2e-22; Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=2e-22; |
Length | 567 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TCCATCACTTCTTTCTTCCTCAAAATCAAGATTTTCAACTTCACTTCCACTTCCTTGTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824654 |
Trichome-related Gene from Literature | N/A |