| Detail of EST/Unigene BI263693 |
| Acc. | BI263693 |
| Internal Acc. | NF091E03PL1F1023 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-21; NifU-like protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-20; NifU-like protein 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-15; Putative nitrogen fixation protein YutI OS=Bacillus subtilis (strain 168) E-value=1e-09; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Drosophila melanogaster E-value=1e-08; |
| Length | 164 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CTCTACATGAAATCGATGGAAATGTTGTACGGTTGAAGTTACAGGGTGCTTGTGGGTCGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835057 |
| Trichome-related Gene from Literature | N/A |