| Detail of EST/Unigene BI263744 |
| Acc. | BI263744 |
| Internal Acc. | NF091C06PL1F1050 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=1e-99; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=5e-79; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=4e-77; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=2e-75; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Nicotiana tabacum E-value=3e-74; |
| Length | 670 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GCAAAATGGCCTCTACACAATGCTTCTTGCACCCCCAATATGCTCTTACAACTCCATCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837178 |
| Trichome-related Gene from Literature | N/A |