| Detail of EST/Unigene BI263855 |
| Acc. | BI263855 |
| Internal Acc. | NF120H01PL1F1016 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Clp protease-related protein At4g12060, chloroplastic OS=Arabidopsis thaliana E-value=4e-24; ATP-dependent Clp protease ATP-binding subunit clpA homolog OS=Cyanidium caldarium E-value=4e-08; Chaperone protein ClpC1, chloroplastic OS=Arabidopsis thaliana E-value=1e-07; Chaperone protein ClpC, chloroplastic OS=Pisum sativum E-value=1e-07; Chaperone protein ClpC2, chloroplastic OS=Arabidopsis thaliana E-value=1e-07; |
| Length | 400 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GAACCCTTCTCTTCGTTTGATTCAGAATTTGAACATAACAAACCCTAACAATTCATGGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826814 |
| Trichome-related Gene from Literature | N/A |