Detail of EST/Unigene BI263855 |
Acc. | BI263855 |
Internal Acc. | NF120H01PL1F1016 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Clp protease-related protein At4g12060, chloroplastic OS=Arabidopsis thaliana E-value=4e-24; ATP-dependent Clp protease ATP-binding subunit clpA homolog OS=Cyanidium caldarium E-value=4e-08; Chaperone protein ClpC1, chloroplastic OS=Arabidopsis thaliana E-value=1e-07; Chaperone protein ClpC, chloroplastic OS=Pisum sativum E-value=1e-07; Chaperone protein ClpC2, chloroplastic OS=Arabidopsis thaliana E-value=1e-07; |
Length | 400 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GAACCCTTCTCTTCGTTTGATTCAGAATTTGAACATAACAAACCCTAACAATTCATGGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826814 |
Trichome-related Gene from Literature | N/A |