Detail of EST/Unigene BI263933 |
Acc. | BI263933 |
Internal Acc. | NF107D08PL1F1074 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=2e-12; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-12; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-12; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=2e-12; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-12; |
Length | 180 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CGGAAAGGGACCTTTGGAGAACCTTGCCGATCATCTTGCCGACCCAGTCAACAACAACGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |