| Detail of EST/Unigene BI264108 |
| Acc. | BI264108 |
| Internal Acc. | NF110C11PL1F1086 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=1e-62; 30S ribosomal protein S3, chloroplastic OS=Glycine max E-value=2e-60; 30S ribosomal protein S3, chloroplastic OS=Phaseolus angularis E-value=6e-59; 30S ribosomal protein S3, chloroplastic OS=Phaseolus vulgaris E-value=4e-58; 30S ribosomal protein S3, chloroplastic OS=Olimarabidopsis pumila E-value=2e-57; |
| Length | 653 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GAATTGCTTTATTCTGCAGGANAAAATGCTAGTCACAATATATAGTTCAACGAACTAAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |