Detail of EST/Unigene BI264156 |
Acc. | BI264156 |
Internal Acc. | NF114A03PL1F1021 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-96; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=5e-96; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=6e-96; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-95; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-95; |
Length | 659 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GCAATCAAGCTTTCCCCTTCGACTCCAGACCTTGTGATGGGAAGAATCACCATGAGGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |