Detail of EST/Unigene BI264209 |
Acc. | BI264209 |
Internal Acc. | NF107F11PL1F1095 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable alanine--tRNA ligase, chloroplastic OS=Populus trichocarpa E-value=1e-38; Probable alanine--tRNA ligase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-36; Probable alanine--tRNA ligase, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-36; Probable alanine--tRNA ligase, chloroplastic OS=Sorghum bicolor E-value=1e-34; Probable alanine--tRNA ligase, chloroplastic OS=Arabidopsis thaliana E-value=4e-34; |
Length | 275 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GTTGAGTGTTTGGATGATGTTGATGCAGAGTCACTTAAAAGTGCCGCAGAATATTTAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832343 |
Trichome-related Gene from Literature | N/A |