Detail of EST/Unigene BI264232 |
Acc. | BI264232 |
Internal Acc. | NF110A03PL1F1021 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit c, chloroplastic OS=Ipomoea purpurea E-value=7e-17; ATP synthase subunit c, chloroplastic OS=Cicer arietinum E-value=7e-17; ATP synthase subunit c, chloroplastic OS=Pisum sativum E-value=9e-17; ATP synthase subunit c, chloroplastic OS=Pinus thunbergii E-value=2e-16; ATP synthase subunit c, chloroplastic OS=Pinus koraiensis E-value=2e-16; |
Length | 642 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | ATAACTCAAAAATGGAAATAAAGAAAAAGAAAGAACGAAGAATTAAAAGAATGGTTCAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |