| Detail of EST/Unigene BI264271 |
| Acc. | BI264271 |
| Internal Acc. | NF113B12PL1F1101 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase delta chain, chloroplastic OS=Spinacia oleracea E-value=3e-09; ATP synthase delta chain, chloroplastic OS=Nicotiana tabacum E-value=3e-07; ATP synthase delta chain, chloroplastic OS=Pisum sativum E-value=1e-06; ATP synthase delta chain, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-06; ATP synthase delta chain, chloroplastic OS=Sorghum bicolor E-value=1e-05; |
| Length | 660 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTCCATGGATACTTTCTCAAGCTCTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827987 |
| Trichome-related Gene from Literature | N/A |