| Detail of EST/Unigene BI264390 |
| Acc. | BI264390 |
| Internal Acc. | NF111H08PL1F1076 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog NTF3 OS=Nicotiana tabacum E-value=1e-52; Mitogen-activated protein kinase homolog 1 OS=Petunia hybrida E-value=9e-52; Mitogen-activated protein kinase 2 OS=Arabidopsis thaliana E-value=2e-51; Mitogen-activated protein kinase 1 OS=Arabidopsis thaliana E-value=1e-49; Mitogen-activated protein kinase 7 OS=Arabidopsis thaliana E-value=3e-49; |
| Length | 646 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GGAAAATGCGGGTGTGTATGTGACTTGGTTTCTTTCTTTTCTTTTTCTTGTGTGTGTGTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04464 mitogen-activated protein kinase 7; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04464 mitogen-activated protein kinase 7 |
| EC | 2.7.11.24 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842248 |
| Trichome-related Gene from Literature | N/A |