Detail of EST/Unigene BI264435 |
Acc. | BI264435 |
Internal Acc. | NF113E07PL1F1055 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-Cys peroxiredoxin BAS1-like, chloroplastic OS=Arabidopsis thaliana E-value=3e-71; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Spinacia oleracea E-value=8e-71; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Arabidopsis thaliana E-value=8e-71; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Triticum aestivum E-value=3e-69; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Hordeum vulgare E-value=3e-69; |
Length | 654 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GGCCTGCTGCTCAGCTCCATCTGCTTCTCTCTTATCTTCAAACCCTAACATCCTCTTCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830517 |
Trichome-related Gene from Literature | N/A |