| Detail of EST/Unigene BI264518 |
| Acc. | BI264518 |
| Internal Acc. | NF114E03PL1F1023 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase, chloroplastic OS=Alnus glutinosa E-value=5e-62; Thiamine thiazole synthase 1, chloroplastic OS=Vitis vinifera E-value=6e-62; Thiamine thiazole synthase, chloroplastic OS=Citrus sinensis E-value=5e-61; Thiamine thiazole synthase 2, chloroplastic OS=Vitis vinifera E-value=7e-61; Thiamine thiazole synthase, chloroplastic OS=Arabidopsis thaliana E-value=6e-59; |
| Length | 586 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | TTTGGTTTCAATGAACCATGACACTCAATCCTGCATGGACCCAAATGTTATGGAGTCTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835567 |
| Trichome-related Gene from Literature | N/A |