Detail of EST/Unigene BI264525 |
Acc. | BI264525 |
Internal Acc. | NF108B04PL1F1041 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-75; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-75; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=5e-75; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-74; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=8e-74; |
Length | 500 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CAACAATGTCTCTCTCTTCTTCATCATTTGTAGGGAAGGCAATCAAGCTTTCCCCATCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |