Detail of EST/Unigene BI264573 |
Acc. | BI264573 |
Internal Acc. | NF118H06PL1F1060 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | DNA ligase 1 OS=Dictyostelium discoideum E-value=1e-12; Nucleolar protein 58 OS=Dictyostelium discoideum E-value=4e-10; Dynein heavy chain-like protein PF11_0240 OS=Plasmodium falciparum (isolate 3D7) E-value=2e-09; DNA topoisomerase 1 OS=Xenopus laevis E-value=5e-09; Transcriptional regulator ATRX homolog OS=Caenorhabditis elegans E-value=6e-09; |
Length | 676 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TTCAGATCAAACTGTTACTGATGTTTCAGAGCAGGGGTCAGGTTCCTCTTCTGAGAAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10747 DNA ligase 1 |
EC | 5.99.1.2 6.5.1.1 |
Transcription Factor Family | NF-YB |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822509 |
Trichome-related Gene from Literature | N/A |