Detail of EST/Unigene BI264743 |
Acc. | BI264743 |
Internal Acc. | NF115A06PL1F1049 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S18, chloroplastic OS=Lactuca sativa E-value=1e-22; 30S ribosomal protein S18, chloroplastic OS=Panax ginseng E-value=3e-22; 30S ribosomal protein S18, chloroplastic OS=Olimarabidopsis pumila E-value=3e-22; 30S ribosomal protein S18, chloroplastic OS=Nasturtium officinale E-value=3e-22; 30S ribosomal protein S18, chloroplastic OS=Lobularia maritima E-value=3e-22; |
Length | 532 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GAAAAATTCTGTCCCTTTTGTTGCAAACATACGATTCACGTCGAGATAAAGAAATAGAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |