| Detail of EST/Unigene BI264743 |
| Acc. | BI264743 |
| Internal Acc. | NF115A06PL1F1049 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S18, chloroplastic OS=Lactuca sativa E-value=1e-22; 30S ribosomal protein S18, chloroplastic OS=Panax ginseng E-value=3e-22; 30S ribosomal protein S18, chloroplastic OS=Olimarabidopsis pumila E-value=3e-22; 30S ribosomal protein S18, chloroplastic OS=Nasturtium officinale E-value=3e-22; 30S ribosomal protein S18, chloroplastic OS=Lobularia maritima E-value=3e-22; |
| Length | 532 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GAAAAATTCTGTCCCTTTTGTTGCAAACATACGATTCACGTCGAGATAAAGAAATAGAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |