Detail of EST/Unigene BI265058 |
Acc. | BI265058 |
Internal Acc. | NF078C06IN1F1050 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phospholipase A1-Igamma3, chloroplastic OS=Arabidopsis thaliana E-value=6e-48; Phospholipase A1-Igamma2, chloroplastic OS=Arabidopsis thaliana E-value=7e-42; Phospholipase A1-Igamma1, chloroplastic OS=Arabidopsis thaliana E-value=3e-41; Galactolipase DONGLE, chloroplastic OS=Arabidopsis thaliana E-value=1e-22; Phospholipase A(1) DAD1, chloroplastic OS=Arabidopsis thaliana E-value=8e-22; |
Length | 674 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CCAACATTCTATCCTCCCATATCCTTCCCATTCCCACCATCTCTTTTCAAAACCCATCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841569 |
Trichome-related Gene from Literature | N/A |