| Detail of EST/Unigene BI265248 |
| Acc. | BI265248 |
| Internal Acc. | NF077B12IN1F1101 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=1e-36; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=7e-34; Probable beta-1,3-galactosyltransferase 4 OS=Arabidopsis thaliana E-value=5e-28; Probable beta-1,3-galactosyltransferase 1 OS=Arabidopsis thaliana E-value=4e-16; Probable beta-1,3-galactosyltransferase 6 OS=Arabidopsis thaliana E-value=4e-07; |
| Length | 657 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | TGCAAACAAGCTACACACCCAACACAACTCACATAGATAGCATAAGATATAAGCTAAGGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839292 |
| Trichome-related Gene from Literature | N/A |