Detail of EST/Unigene BI265263 |
Acc. | BI265263 |
Internal Acc. | NF077F09IN1F1079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Amidase 1 OS=Arabidopsis thaliana E-value=5e-68; Translocon at the outer membrane of chloroplasts 64 OS=Pisum sativum E-value=1e-56; Outer envelope protein 64, chloroplastic OS=Arabidopsis thaliana E-value=1e-56; Outer envelope protein 64, mitochondrial OS=Arabidopsis thaliana E-value=3e-52; Glutamyl-tRNA(Gln) amidotransferase subunit A OS=Methanococcus maripaludis (strain C7 / ATCC BAA-1331) E-value=7e-23; |
Length | 663 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GCTGTTATCATCTGTGAGTGGTTGAAAACGTAATACAGTAGACATGGAAACAGCCTCAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00632 Benzoate degradation via CoA ligation > K01426 amidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01426 amidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K01426 amidase |
EC | 3.5.1.4 |
Transcription Factor Family | |
Transporter Classification Family | 3.A.9 Chloroplast protein translocating system (Tic-Toc) CEPT |
Probeset |
|
Corresponding NCBI Gene | 837418 |
Trichome-related Gene from Literature | N/A |