Detail of EST/Unigene BI265399 |
Acc. | BI265399 |
Internal Acc. | NF082A02IN1F1017 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=3e-52; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=9e-51; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=3e-19; Probable beta-1,3-galactosyltransferase 8 OS=Arabidopsis thaliana E-value=3e-08; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=3e-07; |
Length | 530 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | TTACCAACAACATCGTCGTCGAAGCGAGGTGGAGGAGGAGGAAGATCAAAAATCGTTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829344 |
Trichome-related Gene from Literature | N/A |