| Detail of EST/Unigene BI265399 |
| Acc. | BI265399 |
| Internal Acc. | NF082A02IN1F1017 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=3e-52; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=9e-51; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=3e-19; Probable beta-1,3-galactosyltransferase 8 OS=Arabidopsis thaliana E-value=3e-08; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=3e-07; |
| Length | 530 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | TTACCAACAACATCGTCGTCGAAGCGAGGTGGAGGAGGAGGAAGATCAAAAATCGTTCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829344 |
| Trichome-related Gene from Literature | N/A |