Detail of EST/Unigene BI265423 |
Acc. | BI265423 |
Internal Acc. | NF082E03IN1F1023 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-34; NifU-like protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-29; NifU-like protein 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-24; NifU-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=9e-16; Putative nitrogen fixation protein YutI OS=Bacillus subtilis (strain 168) E-value=3e-15; |
Length | 427 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | AAATCATTACCCGATGCAAGGTGTGGTGGTGCTCAACACACAATCTTACTGCAGAACTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835057 |
Trichome-related Gene from Literature | N/A |