| Detail of EST/Unigene BI265507 |
| Acc. | BI265507 |
| Internal Acc. | NF083F07IN1F1063 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 4, mitochondrial OS=Arabidopsis thaliana E-value=4e-28; NifU-like protein 5, mitochondrial OS=Arabidopsis thaliana E-value=2e-26; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Drosophila melanogaster E-value=1e-16; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Mus musculus E-value=2e-16; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Homo sapiens E-value=2e-16; |
| Length | 663 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CCGCATCGAAGAACCCTAATTCCTTCGACGATTCCTTCTACAATCGAAGATTCCTGTGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821647 |
| Trichome-related Gene from Literature | N/A |