| Detail of EST/Unigene BI265603 |
| Acc. | BI265603 |
| Internal Acc. | NF096A11IN1F1085 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=2e-39; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=9e-34; 50S ribosomal protein L22, chloroplastic OS=Platanus occidentalis E-value=1e-24; 50S ribosomal protein L22, chloroplastic OS=Populus trichocarpa E-value=2e-24; 50S ribosomal protein L22, chloroplastic OS=Populus alba E-value=4e-24; |
| Length | 527 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CAAATACCAATGCCAAAACATTTGATTATAGAATTAAGTTGAATATTCAAACAGTTCTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |