Detail of EST/Unigene BI265603 |
Acc. | BI265603 |
Internal Acc. | NF096A11IN1F1085 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=2e-39; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=9e-34; 50S ribosomal protein L22, chloroplastic OS=Platanus occidentalis E-value=1e-24; 50S ribosomal protein L22, chloroplastic OS=Populus trichocarpa E-value=2e-24; 50S ribosomal protein L22, chloroplastic OS=Populus alba E-value=4e-24; |
Length | 527 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CAAATACCAATGCCAAAACATTTGATTATAGAATTAAGTTGAATATTCAAACAGTTCTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |