| Detail of EST/Unigene BI265734 |
| Acc. | BI265734 |
| Internal Acc. | NF085F04IN1F1043 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Translation initiation factor IF-1, chloroplastic OS=Glycine max E-value=7e-38; Translation initiation factor IF-1, chloroplastic OS=Cercidiphyllum japonicum E-value=5e-31; Translation initiation factor IF-1, chloroplastic OS=Nandina domestica E-value=8e-31; Translation initiation factor IF-1, chloroplastic OS=Buxus microphylla E-value=8e-31; Translation initiation factor IF-1, chloroplastic OS=Montinia caryophyllacea E-value=2e-30; |
| Length | 630 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CTAAAAGCCATCATCATCAAAGAAACATGTTTACCTCATCTTCCATCCCATTCCACGCCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826719 |
| Trichome-related Gene from Literature | N/A |