Detail of EST/Unigene BI265847 |
Acc. | BI265847 |
Internal Acc. | NF110H03IN1F1032 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit III, chloroplastic OS=Flaveria trinervia E-value=2e-52; Photosystem I reaction center subunit III, chloroplastic OS=Arabidopsis thaliana E-value=3e-52; Photosystem I reaction center subunit III, chloroplastic OS=Spinacia oleracea E-value=2e-49; Photosystem I reaction center subunit III, chloroplastic OS=Hordeum vulgare E-value=9e-46; Photosystem I reaction center subunit III OS=Guillardia theta E-value=1e-28; |
Length | 551 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CAAATCCAACACCCTTCACTCCCTCTTCTCTTCTTCTTCCACACAAAAATGTCTCTAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840021 |
Trichome-related Gene from Literature | N/A |