| Detail of EST/Unigene BI266020 |
| Acc. | BI266020 |
| Internal Acc. | NF098C02IN1F1018 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=2e-16; Oxygen-evolving enhancer protein 2-3, chloroplastic OS=Nicotiana tabacum E-value=1e-12; Oxygen-evolving enhancer protein 2, chloroplastic (Fragment) OS=Brassica juncea E-value=5e-09; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=2e-08; Oxygen-evolving enhancer protein 2-2, chloroplastic OS=Nicotiana tabacum E-value=2e-08; |
| Length | 302 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | ATGGCCTCTACACAATGCTTCTTGCACCCCCAATATGCTCTTACAACTCCATCTAGAAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837178 |
| Trichome-related Gene from Literature | N/A |