Detail of EST/Unigene BI266341 |
Acc. | BI266341 |
Internal Acc. | NF091H03IN1F1032 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=8e-28; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=8e-28; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=3e-27; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=7e-27; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=2e-25; |
Length | 321 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CCACCTCATCACACCGATTCGCTATCTCCCCCCGTTCCATCTCAACCAGAATCTCTTCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818978 |
Trichome-related Gene from Literature | 818978 |