| Detail of EST/Unigene BI266377 |
| Acc. | BI266377 |
| Internal Acc. | NF084H01IN1F1016 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=7e-47; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=4e-44; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-44; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=7e-44; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=1e-43; |
| Length | 381 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGGCTCTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818006 |
| Trichome-related Gene from Literature | N/A |