Detail of EST/Unigene BI266397 |
Acc. | BI266397 |
Internal Acc. | NF103G10IN1F1084 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastoglobulin-1, chloroplastic OS=Pisum sativum E-value=1e-33; Plastid lipid-associated protein 3, chloroplastic OS=Brassica campestris E-value=1e-09; Probable plastid-lipid-associated protein 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-09; Probable plastid-lipid-associated protein 3, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-08; |
Length | 363 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTCGCTCTCACAGATTCCCTTCTCTCCGCTTCATCTCCGCCACCGGCGACATCGGAGACG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818114 |
Trichome-related Gene from Literature | N/A |