| Detail of EST/Unigene BI266434 |
| Acc. | BI266434 |
| Internal Acc. | NF104B02IN1F1016 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aconitate hydratase 1 OS=Arabidopsis thaliana E-value=2e-08; Aconitate hydratase 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-08; Putative aconitate hydratase, cytoplasmic OS=Oryza sativa subsp. japonica E-value=4e-08; Aconitate hydratase, cytoplasmic OS=Cucurbita maxima E-value=3e-07; Aconitate hydratase 3, mitochondrial OS=Arabidopsis thaliana E-value=4e-07; |
| Length | 181 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CTTATTATTATTACCTTCGTTCTTCACGCTCTCTATTTTTCTCTCTCGATCTCAATCTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829737 |
| Trichome-related Gene from Literature | N/A |