Detail of EST/Unigene BI266488 |
Acc. | BI266488 |
Internal Acc. | NF098D12IN1F1102 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Tricyclene synthase TPS4, chloroplastic OS=Medicago truncatula E-value=0; Tricyclene synthase EBOS, chloroplastic OS=Lotus japonicus E-value=7e-60; Isoprene synthase, chloroplastic OS=Populus canescens E-value=2e-34; Isoprene synthase, chloroplastic OS=Pueraria montana var. lobata E-value=3e-34; Isoprene synthase, chloroplastic OS=Populus alba E-value=7e-34; |
Length | 654 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTCTTCCTTATTCTCTCACTTGCAAAGAACTCTTCCTTTATATCACAAGTATCCCTATAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816955 |
Trichome-related Gene from Literature | N/A |