Detail of EST/Unigene BI266491 |
Acc. | BI266491 |
Internal Acc. | NF098E02IN1F1019 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=3e-40; Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-36; Lipoxygenase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-35; Lipoxygenase 2.2, chloroplastic OS=Hordeum vulgare E-value=6e-35; Lipoxygenase 2.1, chloroplastic OS=Hordeum vulgare E-value=2e-34; |
Length | 338 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GCACCGAGGCNTGTGAATTTTTCTTGTGAATCATGGGTTCATTCCAAGCATGACAACCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843584 |
Trichome-related Gene from Literature | N/A |