Detail of EST/Unigene BI266782 |
Acc. | BI266782 |
Internal Acc. | NF091F05IN1F1047 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Estradiol 17-beta-dehydrogenase 12 OS=Xenopus tropicalis E-value=1e-12; Estradiol 17-beta-dehydrogenase 12-B OS=Xenopus laevis E-value=4e-12; Estradiol 17-beta-dehydrogenase 12 OS=Rattus norvegicus E-value=9e-12; 3-ketoacyl-CoA reductase OS=Aspergillus oryzae (strain ATCC 42149 / RIB 40) E-value=3e-11; 3-ketoacyl-CoA reductase OS=Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545) E-value=4e-11; |
Length | 407 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CAATAAATCCATTGCTGCTACTCTCATTTTTTTCATAAATAAATCAACCCCTCTCTCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
EC | 1.1.1.- 1.1.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843098 |
Trichome-related Gene from Literature | N/A |