Detail of EST/Unigene BI266914 |
Acc. | BI266914 |
Internal Acc. | NF097B03IN1F1029 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase gamma chain, chloroplastic OS=Pisum sativum E-value=4e-34; ATP synthase gamma chain, chloroplastic OS=Nicotiana tabacum E-value=8e-27; ATP synthase gamma chain 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-21; ATP synthase gamma chain, chloroplastic OS=Spinacia oleracea E-value=5e-15; ATP synthase subunit gamma, chloroplastic OS=Zea mays E-value=2e-14; |
Length | 312 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTCATCATTGCAACAATGTCTTGCTCCAATATCACCATGTTGGTCTCATCCAAACCTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825797 |
Trichome-related Gene from Literature | N/A |