Detail of EST/Unigene BI266943 |
Acc. | BI266943 |
Internal Acc. | NF097F11IN1F1095 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=4e-83; Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=2e-81; Chlorophyll a-b binding protein 1B-21, chloroplastic OS=Hordeum vulgare Ib-21 E-value=3e-77; Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=8e-26; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=1e-23; |
Length | 558 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | TCCATCACTTCTTTCTTCCTCAAAATCAAGATTTTCAACTTCACTTCCACTTCCTTGTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824654 |
Trichome-related Gene from Literature | N/A |