| Detail of EST/Unigene BI266986 |
| Acc. | BI266986 |
| Internal Acc. | NF090D11IN1F1094 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=3e-27; Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=4e-19; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=5e-18; Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=7e-17; Serine hydroxymethyltransferase 2, mitochondrial OS=Flaveria pringlei E-value=4e-16; |
| Length | 266 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | ATCTATCTCATCTCTGAGATGGCAATGGCAATGGCTCTTCGTAGGCTTTCTTCTTCCATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829949 |
| Trichome-related Gene from Literature | 829949 |