| Detail of EST/Unigene BI267041 |
| Acc. | BI267041 |
| Internal Acc. | NF091H09IN1F1080 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Tricyclene synthase TPS4, chloroplastic OS=Medicago truncatula E-value=4e-66; Tricyclene synthase EBOS, chloroplastic OS=Lotus japonicus E-value=2e-34; Isoprene synthase, chloroplastic OS=Populus canescens E-value=1e-15; (+)-alpha-pinene synthase, chloroplastic OS=Cannabis sativa E-value=3e-15; Isoprene synthase, chloroplastic OS=Populus alba E-value=3e-15; |
| Length | 433 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CTCTCACTTGCAAAGAACTCTTCCTTTATATCACAAGTATCCCTATACAATTCATCCAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827377 |
| Trichome-related Gene from Literature | N/A |