Detail of EST/Unigene BI267065 |
Acc. | BI267065 |
Internal Acc. | NF107B09IN1F1076 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycerate dehydrogenase OS=Cucumis sativus E-value=2e-66; Glyoxylate reductase OS=Thermococcus litoralis E-value=2e-21; Glyoxylate reductase OS=Pyrococcus abyssi (strain GE5 / Orsay) E-value=2e-20; Glyoxylate reductase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=3e-20; Glyoxylate reductase OS=Thermofilum pendens (strain Hrk 5) E-value=3e-20; |
Length | 680 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | AGGTGGCAAAAATATCTCATCTTTTATTTTAAAGGATTCTTGGTTCAATTGANAATTTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00015 glyoxylate reductase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+) |
EC | 1.1.1.26 1.1.1.79 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843129 |
Trichome-related Gene from Literature | N/A |