| Detail of EST/Unigene BI267066 |
| Acc. | BI267066 |
| Internal Acc. | NF100A05IN1F1065 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Heme oxygenase 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-63; Heme oxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-58; Heme oxygenase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-54; Heme oxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=4e-46; Probable inactive heme oxygenase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; |
| Length | 681 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | GTCACTAACACCTCTCTACCAAATCCAATCCATTTTTCATTATAAAACCAATTACCCCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817208 |
| Trichome-related Gene from Literature | N/A |