Detail of EST/Unigene BI267138 |
Acc. | BI267138 |
Internal Acc. | NF101C05IN1F1038 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=4e-93; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=9e-80; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=6e-79; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=5e-77; Oxygen-evolving enhancer protein 1, chloroplastic OS=Helianthus annuus E-value=3e-75; |
Length | 606 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GTTAACATAGGAGCAATGGCAGCCTCACTCCAAGCAGCTGCTACTCTCATGCAACCAACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836789 |
Trichome-related Gene from Literature | N/A |