| Detail of EST/Unigene BI267556 |
| Acc. | BI267556 |
| Internal Acc. | NF111H08IN1F1076 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Quinone oxidoreductase-like protein At1g23740, chloroplastic OS=Arabidopsis thaliana E-value=1e-50; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=7e-16; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=2e-14; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=2e-14; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=1e-13; |
| Length | 587 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | ATAAGCTGATATTTTATTATCCTCAAATCACTTTTATCAAATAATTCATTTCTCATTTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.6.5.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838984 |
| Trichome-related Gene from Literature | N/A |