| Detail of EST/Unigene BI267726 |
| Acc. | BI267726 |
| Internal Acc. | NF112B08IN1F1073 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable acyl-activating enzyme 18, peroxisomal OS=Arabidopsis thaliana E-value=1e-76; Probable acyl-activating enzyme 17, peroxisomal OS=Arabidopsis thaliana E-value=2e-53; Acetyl-coenzyme A synthetase OS=Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145) E-value=1e-10; Acetyl-coenzyme A synthetase OS=Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / LMG 4051 / NBRC 15346 / NCIMB 9279 / R1 / VKM B-1422) E-value=2e-10; Acetyl-coenzyme A synthetase OS=Cronobacter sakazakii (strain ATCC BAA-894) E-value=3e-10; |
| Length | 605 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | TCGAGTCATTGAGGCAGCTGCAAGTAAAGTTATCGTGCTCCCTGTGATAGGTGATGATGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01908 propionyl-CoA synthetase |
| EC | 6.2.1.1 6.2.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841977 |
| Trichome-related Gene from Literature | N/A |