| Detail of EST/Unigene BI267756 |
| Acc. | BI267756 |
| Internal Acc. | NF110G01IN1F1008 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=1e-42; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=2e-15; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=1e-13; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=2e-13; Carbonic anhydrase OS=Flaveria pringlei E-value=3e-10; |
| Length | 388 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CCATAAACGGCTTTAGTCTCTCTTCTTTGTCCCCTACAAAAACTTCTATTAAAAAAGTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821134 |
| Trichome-related Gene from Literature | N/A |