| Detail of EST/Unigene BI267910 |
| Acc. | BI267910 |
| Internal Acc. | NF114D11IN1F1094 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase large chain OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=1e-54; Carbamoyl-phosphate synthase large chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=5e-51; Carbamoyl-phosphate synthase large chain OS=Halomonas eurihalina E-value=4e-39; Carbamoyl-phosphate synthase large chain OS=Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS) E-value=1e-38; Carbamoyl-phosphate synthase large chain OS=Xanthomonas campestris pv. campestris (strain ATCC 33913 / NCPPB 528 / LMG 568) E-value=6e-38; |
| Length | 526 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CTAGTTTTGAGCCTTCTATTGATTATGTGGTTACTAAGATTCCTCGGTTTGCTTTTGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01948 carbamoyl-phosphate synthase (ammonia) |
| EC | 6.3.4.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839868 |
| Trichome-related Gene from Literature | N/A |