| Detail of EST/Unigene BI267942 |
| Acc. | BI267942 |
| Internal Acc. | NF112G09IN1F1072 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=2e-45; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=2e-38; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=1e-37; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=2e-37; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=3e-37; |
| Length | 300 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | AACAAACATCAAGAAACCTCAACGCCCTCATGGCCACCTCTGCAATCCAACAATCAGCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815058 |
| Trichome-related Gene from Literature | N/A |