Detail of EST/Unigene BI267946 |
Acc. | BI267946 |
Internal Acc. | NF118C08IN1F1066 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M4, chloroplastic OS=Arabidopsis thaliana E-value=2e-49; Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=3e-45; Thioredoxin M2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-44; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=3e-44; Thioredoxin M1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-43; |
Length | 623 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CACATTTCACACACTTTTCCAGAGCTACGATTCTCTGCAATCATGGCCACCGTACAACTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820775 |
Trichome-related Gene from Literature | N/A |