| Detail of EST/Unigene BI268008 |
| Acc. | BI268008 |
| Internal Acc. | NF116F05IN1F1047 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=2e-23; Transketolase, chloroplastic OS=Spinacia oleracea E-value=7e-23; Transketolase, chloroplastic OS=Solanum tuberosum E-value=2e-22; Transketolase, chloroplastic OS=Zea mays E-value=4e-21; Transketolase 10 OS=Craterostigma plantagineum E-value=1e-20; |
| Length | 157 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CACTACCATTGGATTTGGTTCTCCAAACAAAGCTAATTCCTACAGTGTTCACGGAGCCGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819137 |
| Trichome-related Gene from Literature | N/A |